 |
|
|
|
Two hundred micrograms of the obtained total RNA were subjected to oligo-capping with
some modifications from the original protocol; namely, after the successive treatment
of the RNA with 2.5 U BAP (TaKaRa) at 37 °C for 1 hour and 40 U TAP (Ambion) at 37 °C
for 1 hour, the BAP-TAP-treated RNAs were ligated with 1.2 micrograms of the following RNA
oligo (5'- AAUGAUACGGCGACCACCGAGAUCUACACUCUUUCCCUACACGACGCUCUUCCGAUCUGG-3'), using 250 U
T4 RNA ligase (TaKaRa) at 20 °C for 3 hours. After the DNase I treatment (TaKaRa),
polyA-containing RNA was selected using oligo-dT powder ,(Collaborative).
The first strand cDNA was synthesized from 10 picomoles of random hexamer primer
(5'-CAAGCAGAAGACGGCATACGANNNNNNC-3') using Super Script II (Invitrogen),by an incubation
at 12 °C for 1 hour and at 42 °C overnight. The template RNA was degraded by an alkaline
treatment. For PCR, a 20% portion of the first strand cDNAs was used as the PCR template.
Gene Amp PCR kits (PerkinElmer) were used with the PCR primers 5'-AATGATACGGCGACCACCGAG-3'
and 5'-CAAGCAGAAGACGGCATACGA-3',under the following reaction conditions: 15 cycles of
94 °C for 1 minute, 56 °C for 1 minute and 72 °C for 2 minutes,The PCR fragments were
size-fractionated by 12 % polyacrylamide gel electrophoresis, and the fraction containing
the 150-250 bp fragments was recovered.The quality and quantity of the obtained
single-stranded first strand cDNAs were assessed, using a BioAnalyzer (Agilent).
One nanogram of the size-fractionated cDNA was used for the sequencing reactions with the Illumina GA.
The sequencing reactions were performed according to the manufacturer's instructions
The 36-bp read TSS tags were mapped onto the human genome sequence (hg18, UCSC Genome Browser)
using ELAND. Uniquely and completely (without any mismatches) mapped TSS tags were used
for the analysis. After the clustering of the mapped TSS tags into the 500-bp bin,
the TSS clusters located within the region from -50 kb of the 5'-end to the 3'-end boundary
of the RefSeq gene were selected. TSS clusters were removed when all of the belonging
TSS tags were located at the internal exonic region of the corresponding RefSeq genes.
The RefSeq information, such as the genomic coordinates, the position of the protein
coding region, etc, is from hg18. Gene Ontology terms were correlated with RefSeq, using loc2go.
Briefly, TSS Seq combines our full-length cDNA technology, oligo-capping (Suzuki
and Sugano, Methods in Mol Biol, 2003), and Illumina GA technology. Adaptors
necessary for Illumina sequencing is introduced to the cap site by three steps of
enzymatic reactions, which enables to determine the immediately downstream
sequences of the TSSs (TSS tag). Adaptors containing necessary sequence for the
Illumina GA sequencer are represented as gray boxes. For further information, see
the reference. Gppp: cap structure. AAA: polyA
|
|
|
|
|
|